modified pbluescript ii ks (+) vector (Agilent technologies)
Agilent technologies is a verified supplier 
Agilent technologies manufactures this product 
90
Structured Review
Agilent technologies
modified pbluescript ii ks (+) vector
Modified Pbluescript Ii Ks (+) Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbluescript+ks++vector/bio_rxiv__2024__05__24__595694-255-41-46
Average 90 stars, based on 1 article reviews
Modified Pbluescript Ii Ks (+) Vector, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbluescript+ks++vector/bio_rxiv__2024__05__24__595694-255-41-46
Average 90 stars, based on 1 article reviews
modified pbluescript ii ks (+) vector - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Mutagenesis:Article Title: Development of a highly sensitive method for detection of JAK2V617F Article Snippet: .. As described previously [ ], 521-bp DNA fragments from genomic DNAs containing wild type and V617F mutation JAK2 were amplified with primers P1 (5'- GATCTCCATATTCCAGGCTTACACA) and P1r (5'- TATTGTTTGGGCATTGTAACCTTCT) and then cloned into the Amplification:Article Title: Development of a highly sensitive method for detection of JAK2V617F Article Snippet: .. As described previously [ ], 521-bp DNA fragments from genomic DNAs containing wild type and V617F mutation JAK2 were amplified with primers P1 (5'- GATCTCCATATTCCAGGCTTACACA) and P1r (5'- TATTGTTTGGGCATTGTAACCTTCT) and then cloned into the Clone Assay:Article Title: Development of a highly sensitive method for detection of JAK2V617F Article Snippet: .. As described previously [ ], 521-bp DNA fragments from genomic DNAs containing wild type and V617F mutation JAK2 were amplified with primers P1 (5'- GATCTCCATATTCCAGGCTTACACA) and P1r (5'- TATTGTTTGGGCATTGTAACCTTCT) and then cloned into the Article Title: Acheron/Larp6 Is a Survival Protein That Protects Skeletal Muscle From Programmed Cell Death During Development Article Snippet: .. A portion of Acheron cDNA encoding amino acids 18–409 was cloned into the Article Title: Small circRNAs with self-cleaving ribozymes are frequently expressed in metazoan transcriptomes Article Snippet: RNAs were reverse-transcribed with SuperScript II (Invitrogen), and PCR-amplified with adjacent divergent primers previously phosphorylated, using Prime Star HS DNA polymerase. .. PCR products were cloned into a linearised Article Title: Small circRNAs with self-cleaving ribozymes are highly expressed in diverse metazoan transcriptomes Article Snippet: RNAs were reverse-transcribed with SuperScript II (Invitrogen), and PCR-amplified with adjacent divergent primers previously phosphorylated, using Prime Star HS DNA polymerase. .. PCR products were cloned into a linearised Article Title: Mouse Tryptase Gene Expression is Coordinately Regulated by GATA1 and GATA2 in Bone Marrow-Derived Mast Cells Article Snippet: .. The resulting 5′ (1.1 kb) and 3′ (1 kb) arms and the PGK-gb2-neo template (Gene Bridges, Heidelberg, Germany) were cloned into a Plasmid Preparation:Article Title: Development of a highly sensitive method for detection of JAK2V617F Article Snippet: .. As described previously [ ], 521-bp DNA fragments from genomic DNAs containing wild type and V617F mutation JAK2 were amplified with primers P1 (5'- GATCTCCATATTCCAGGCTTACACA) and P1r (5'- TATTGTTTGGGCATTGTAACCTTCT) and then cloned into the Article Title: Acheron/Larp6 Is a Survival Protein That Protects Skeletal Muscle From Programmed Cell Death During Development Article Snippet: .. A portion of Acheron cDNA encoding amino acids 18–409 was cloned into the Article Title: Docking of acetyl-CoA carboxylase to the plastid envelope membrane attenuates fatty acid production in plants Article Snippet: .. To construct the Pro35S:CTI1:HA transgene, a Hind III/ Stu I fragment of the pGWB14 binary vector containing a 35S promoter-R1-CmR-ccdB-R2-3xHA-NosT sequence was Hind III/ Sma I inserted in the Article Title: Small circRNAs with self-cleaving ribozymes are frequently expressed in metazoan transcriptomes Article Snippet: RNAs were reverse-transcribed with SuperScript II (Invitrogen), and PCR-amplified with adjacent divergent primers previously phosphorylated, using Prime Star HS DNA polymerase. .. PCR products were cloned into a linearised Article Title: Small circRNAs with self-cleaving ribozymes are highly expressed in diverse metazoan transcriptomes Article Snippet: RNAs were reverse-transcribed with SuperScript II (Invitrogen), and PCR-amplified with adjacent divergent primers previously phosphorylated, using Prime Star HS DNA polymerase. .. PCR products were cloned into a linearised Article Title: Enhancement of homology-directed repair with chromatin donor templates in cells Article Snippet: The T2A-EGFP sequence was PCR-amplified from the PX461 plasmid (Addgene plasmid # 48140) with the following oligonucleotides: agagatggatccGAGGGCAGAGGAAGTCTGCT and agagatggtaccTTACTTGTACAGCTCGTCCA . .. Then, the three DNA fragments were sequentially subcloned into the Article Title: Mouse Tryptase Gene Expression is Coordinately Regulated by GATA1 and GATA2 in Bone Marrow-Derived Mast Cells Article Snippet: .. The resulting 5′ (1.1 kb) and 3′ (1 kb) arms and the PGK-gb2-neo template (Gene Bridges, Heidelberg, Germany) were cloned into a Article Title: Characterization of the protease domain of Rice tungro bacilliform virus responsible for the processing of the capsid protein from the polyprotein Article Snippet: .. Cloning was conducted in Binding Assay:Article Title: Acheron/Larp6 Is a Survival Protein That Protects Skeletal Muscle From Programmed Cell Death During Development Article Snippet: .. A portion of Acheron cDNA encoding amino acids 18–409 was cloned into the Construct:Article Title: Docking of acetyl-CoA carboxylase to the plastid envelope membrane attenuates fatty acid production in plants Article Snippet: .. To construct the Pro35S:CTI1:HA transgene, a Hind III/ Stu I fragment of the pGWB14 binary vector containing a 35S promoter-R1-CmR-ccdB-R2-3xHA-NosT sequence was Hind III/ Sma I inserted in the Sequencing:Article Title: Docking of acetyl-CoA carboxylase to the plastid envelope membrane attenuates fatty acid production in plants Article Snippet: .. To construct the Pro35S:CTI1:HA transgene, a Hind III/ Stu I fragment of the pGWB14 binary vector containing a 35S promoter-R1-CmR-ccdB-R2-3xHA-NosT sequence was Hind III/ Sma I inserted in the Polymerase Chain Reaction:Article Title: Small circRNAs with self-cleaving ribozymes are frequently expressed in metazoan transcriptomes Article Snippet: RNAs were reverse-transcribed with SuperScript II (Invitrogen), and PCR-amplified with adjacent divergent primers previously phosphorylated, using Prime Star HS DNA polymerase. .. PCR products were cloned into a linearised Article Title: Small circRNAs with self-cleaving ribozymes are highly expressed in diverse metazoan transcriptomes Article Snippet: RNAs were reverse-transcribed with SuperScript II (Invitrogen), and PCR-amplified with adjacent divergent primers previously phosphorylated, using Prime Star HS DNA polymerase. .. PCR products were cloned into a linearised Ligation:Article Title: Small circRNAs with self-cleaving ribozymes are frequently expressed in metazoan transcriptomes Article Snippet: RNAs were reverse-transcribed with SuperScript II (Invitrogen), and PCR-amplified with adjacent divergent primers previously phosphorylated, using Prime Star HS DNA polymerase. .. PCR products were cloned into a linearised Article Title: Small circRNAs with self-cleaving ribozymes are highly expressed in diverse metazoan transcriptomes Article Snippet: RNAs were reverse-transcribed with SuperScript II (Invitrogen), and PCR-amplified with adjacent divergent primers previously phosphorylated, using Prime Star HS DNA polymerase. .. PCR products were cloned into a linearised Cloning:Article Title: Characterization of the protease domain of Rice tungro bacilliform virus responsible for the processing of the capsid protein from the polyprotein Article Snippet: .. Cloning was conducted in |